Class 12 Biology · Chapter 5
Short answer:
Chapter 5 – Molecular Basis of Inheritance Class 12 Biology (NCERT, Unit VII – Genetics and Evolution) ka wo chapter hai jahan Chapter 4 ke Mendelian genetics ko molecular level pe explain kiya jaata hai — matlab genes asal mein DNA hain, aur inheritance ka pura mechanism replication → transcription → translation ke through chalta hai.
Agar aap molecular basis of inheritance ncert pdf download karke revision kar rahe ho, to yaad rakho ye ek conceptually dense aur core chapter hai — Hershey-Chase experiment, Watson-Crick DNA structure, semi-conservative replication (Meselson-Stahl), central dogma, genetic code ki properties, aur lac operon — ye topics chapter ke core concepts hain, isliye inhe achhe se prepare karna zaroori hai.
Chapter 4 (Principles of Inheritance and Variation) mein aapne Mendel ke laws padhe — dominant/recessive, segregation, independent assortment. Lekin Mendel ko khud pata nahi tha ki uska "factor" asal mein kya hota hai. Chapter 5 wahi gap bharta hai: yahan pata chalta hai ki heredity ka physical aur chemical basis DNA hai, aur ye kaise copy hota hai (replication), kaise "read" hota hai (transcription), aur kaise protein mein convert hota hai (translation).
Ye chapter conceptually dense hai kyunki ismein teen alag-alag landmark discoveries ek saath aati hain — pehle Avery-MacLeod-McCarty aur Hershey-Chase ke experiments jo prove karte hain ki DNA hi genetic material hai, protein nahi; phir Watson-Crick ka double helix structure; aur phir Meselson-Stahl ka semi-conservative replication proof. Iske baad transcription, genetic code, translation, aur gene regulation (lac operon) sequentially build hote hain. Aakhri do sections — Human Genome Project aur DNA Fingerprinting — application-based hain aur short-answer/2-mark questions ke liye important hain.
Is chapter ko theek se samajhne ke baad Chapter 6 Evolution kaafi aasan lagta hai, kyunki mutation aur variation ka molecular origin yahin se clear hota hai.
Chapter 5 Summary — 5 Minute Revision
1. DNA hi genetic material hai — proof: Griffith ka transformation experiment (1928, Streptococcus pneumoniae) ne pehli baar hint diya ki koi "transforming principle" hoti hai. Avery, MacLeod aur MacCarty (1933-44) ne enzymatic treatments se prove kiya ki DNA hi ye transforming principle hai (protein/RNA/lipid destroy karne se transformation par asar nahi pada, DNase se ho gaya). Hershey-Chase (1952) ne bacteriophage aur radioactive labelling (32P for DNA, 35S for protein) se final proof diya.
2. DNA ki structure: Watson aur Crick (1953) ne double helix model diya — do antiparallel, complementary polynucleotide chains, A-T aur G-C base pairing (2 aur 3 hydrogen bonds respectively), 10 bp/turn, 34 Å pitch. DNA nucleus mein histone proteins ke saath packaged hoti hai — nucleosome (histone octamer + ~200 bp DNA) basic packaging unit hai.
3. DNA Replication: Semi-conservative — har daughter molecule mein ek parental + ek naya strand. Meselson-Stahl experiment (15N/14N) ne ise prove kiya. DNA polymerase enzyme replication karta hai, lekin primer ki zaroorat hoti hai aur sirf 5'→3' direction mein synthesis karta hai — isliye ek strand continuous (leading) aur doosri discontinuous (lagging, Okazaki fragments) banti hai.
4. Transcription: DNA se RNA banane ka process, RNA polymerase dwara. Transcription unit ke 3 parts — promoter, structural gene, terminator. Prokaryotes mein ek hi RNA polymerase (sigma factor initiation ke liye, rho factor termination ke liye), no post-processing. Eukaryotes mein 3 RNA polymerases (Pol I → rRNA, Pol II → hnRNA/mRNA, Pol III → tRNA), aur hnRNA ko capping, tailing, splicing (intron removal) ke through process karke mature mRNA banti hai.
5. Genetic Code: Triplet, 64 codons (61 sense + 3 stop: UAA, UAG, UGA), AUG start codon, degenerate lekin unambiguous, nearly universal, non-overlapping, comma-less. Wobble hypothesis explain karta hai ki ek tRNA multiple codons kaise recognise karta hai.
6. tRNA — adaptor molecule: Clover-leaf secondary structure, anticodon loop mRNA codon se pair hota hai, 3' acceptor end (CCA) amino acid carry karta hai.
7. Translation: Amino acid activation → charging of tRNA → initiation (start codon pe small subunit + initiator tRNA + large subunit) → elongation (peptide bond formation, peptidyl transferase ek ribozyme activity hai) → termination (stop codon pe release factor).
8. Regulation of gene expression — lac operon: Prokaryotic gene regulation ka classic model. lac I (regulator) repressor banata hai jo operator se bind karke transcription block karta hai. Lactose ka isomer allolactose inducer hai — repressor ko inactivate karke operon ON kar deta hai.
9. Human Genome Project: Poore human genome ki sequencing ka international project — genome mapping mein sequence annotation, gene mapping, SNPs identification jaisi techniques use hui.
10. DNA Fingerprinting: VNTR (satellite DNA) polymorphism pe based technique — forensic science aur paternity testing mein use hoti hai. Har individual (identical twins ke alawa) ka unique banding pattern hota hai.
In-Text Questions — Solutions
DNA hi genetic material kyun hai, RNA kyun nahi (zyaadatar organisms mein)?
DNA ki deoxyribose sugar mein 2'-OH group nahi hota (jo RNA ki ribose mein hota hai), isliye DNA chemically zyada stable aur less reactive hai. Saath hi DNA usually double-stranded hoti hai, jisse agar ek strand mein damage ho to doosri strand se repair ho sakta hai. RNA single-stranded aur zyada mutable hoti hai — isliye zyaadatar organisms DNA ko genetic material ki tarah use karte hain, jabki kuch viruses (jinhe fast evolve hona hota hai) RNA use karte hain.
Semi-conservative replication ka simple matlab kya hai?
Jab DNA replicate hoti hai, to dono parental strands separate ho jaati hain aur har ek naye strand ke liye template ka kaam karti hai. Result: har daughter DNA molecule mein ek purani (parental) strand aur ek nayi strand hoti hai — poora molecule na to purana rehta hai (conservative) na poora mix hota hai (dispersive).
Central Dogma kya hai aur iska exception kya hai?
Francis Crick ne propose kiya ki genetic information ka flow ek fixed direction mein hota hai: DNA → RNA → Protein. Exception hai retroviruses (jaise HIV) mein, jahan reverse transcriptase enzyme RNA se DNA banata hai (RNA → DNA) — isliye ise 'central dogma ka reverse flow' bhi kaha jaata hai.
Genetic code 'degenerate' hai — iska matlab kya hai?
Degenerate matlab ek se zyada codons ek hi amino acid ko code kar sakte hain — jaise Leucine aur Serine ke liye 6-6 codons hain. Ye redundancy mutations ke against ek protective effect deti hai. Important: degenerate hone ka matlab ambiguous hona nahi — har codon phir bhi sirf ek hi specific amino acid specify karta hai.
Wobble hypothesis kya explain karta hai?
Wobble hypothesis ye explain karti hai ki ek hi tRNA molecule multiple synonymous codons ko kaise recognise kar leta hai. Codon ke third base (jo tRNA ke anticodon ke first/5' base se pair hota hai) mein pairing thodi 'loose' ya flexible hoti hai — isse ek tRNA se hi kaam chal jaata hai chahe codon ka third base different ho.
lac operon mein inducer kaun hai aur kaise trigger karta hai?
Lactose ka isomer allolactose inducer ki tarah kaam karta hai. Ye repressor protein se bind karke uski shape change kar deta hai, jisse repressor operator region se detach ho jaata hai. Isse RNA polymerase free hokar structural genes (Z, Y, A) transcribe kar paati hai, jisse lactose-metabolising enzymes ban jaate hain.
Eukaryotic mRNA ko processing (capping, tailing, splicing) ki zaroorat kyun hoti hai, jabki prokaryotic mRNA ko nahi?
Eukaryotic primary transcript (hnRNA) mein introns hote hain jo splicing se remove karke exons ko join karna zaroori hai, tabhi functional mRNA banta hai. Capping (5' methyl-G cap) aur tailing (3' poly-A tail) mRNA ko degradation se bachate hain aur ribosome recognition/nuclear export mein help karte hain. Prokaryotes mein nuclear membrane nahi hoti aur zyaadatar genes mein introns bhi nahi hote, isliye unki polycistronic mRNA directly translation ke liye use ho jaati hai — processing ki zaroorat nahi padti.

Poore Class 12 Biology ke handwritten colour notes
IITian & district toppers ke banaye short notes — revision-ready, diagram ke saath. Board se pehle poora syllabus 3 din me revise.
Exercise Questions — Solutions (Q1–Q19)
Group the following as nitrogenous bases and nucleosides: Adenine, Cytidine, Thymine, Guanosine, Uracil and Guanine.
Nitrogenous bases (sirf base, sugar-phosphate nahi): Adenine, Thymine, Uracil, Guanine.
Nucleosides (base + sugar, phosphate nahi): Cytidine (Cytosine + ribose), Guanosine (Guanine + ribose).
Yaad rakho — base + sugar = nucleoside; nucleoside + phosphate = nucleotide. '-idine/-osine' ending wale naam nucleosides hain.
If a double stranded DNA has 20 percent of cytosine, calculate the percent of adenine in the DNA.
Chargaff's rule ke hisaab se double-stranded DNA mein %C = %G (kyunki C hamesha G se pair karta hai).
%C = 20% ⇒ %G = 20% (C ≡ G)
%C + %G = 20% + 20% = 40%
Remaining % (A + T) = 100% − 40% = 60%
Chunki A hamesha T se pair karta hai, A = T, isliye 60% ko 2 se divide karo:
%A = %T = 60% ÷ 2 = 30%
If the sequence of one strand of DNA is written as: 5'-ATGCATGCATGCATGCATGCATGCATGC-3', write down the sequence of the complementary strand in 5'→3' direction.
Complementary strand antiparallel hoti hai (3'→5' original ke against) aur base-pairing rule follow karti hai: A↔T, G↔C.
Given (5'→3'): ATGCATGCATGCATGCATGCATGCATGC
Complement (3'→5'): TACGTACGTACGTACGTACGTACGTACG
Isko standard 5'→3' convention mein likhne ke liye reverse karo:
5'-GCATGCATGCATGCATGCATGCATGCAT-3'
If the sequence of one strand of DNA is written as: 5'-ATGCATGCATGCATGCATGCATGCATGC-3', write down the sequence of mRNA using the above as a template.
Yahaan yehi strand template ki tarah use ho rahi hai, isliye mRNA is strand ki complementary aur antiparallel copy hogi, sirf T ki jagah U aayega.
Template (5'→3'): ATGCATGCATGCATGCATGCATGCATGC
mRNA (5'→3', T→U): GCAUGCAUGCAUGCAUGCAUGCAUGCAU
Note: mRNA hamesha template strand ke complementary hoti hai, aur coding/sense strand ke sequence jaisi hoti hai (bas T ki jagah U).
Which property of DNA double helix led Watson and Crick to hypothesise the semi-conservative mode of DNA replication? Explain.
Watson-Crick model mein DNA ki do strands complementary aur antiparallel hoti hain (A-T aur G-C base pairing ke saath). Isi complementarity ne unhe idea diya ki agar do strands separate ho jaayein, to har strand apni complementary strand banane ke liye template ka kaam kar sakti hai.
Isliye replication ke baad har daughter DNA molecule mein ek parental (purani) strand aur ek newly synthesised strand hoti hai — isi ko semi-conservative replication kehte hain. Ye hypothesis baad mein Meselson aur Stahl (1958) ne E. coli aur 15N/14N density-gradient centrifugation experiment se prove ki.
Depending upon the type of point mutation, how would you classify the mutations?
Point mutation ek single base pair ke change se hoti hai. Do broad categories hain:
- Substitution — ek base doosre base se replace ho jaata hai. Aage do types: Transition (purine↔purine ya pyrimidine↔pyrimidine, jaise A↔G ya C↔T) aur Transversion (purine↔pyrimidine, jaise A↔C).
- Insertion / Deletion — ek ya zyada base pairs add ya remove ho jaate hain, jisse frameshift mutation ho jaati hai kyunki poora reading frame shift ho jaata hai (e.g. sickle-cell anaemia substitution ka classic example hai, jabki frameshift insertion/deletion se hoti hai).
What is the coding sequence often referred to as? Why?
Coding strand ko 'sense strand' bhi kehte hain, kyunki iska sequence mRNA ke sequence jaisa hi hota hai (sirf T ki jagah U). Chunki mRNA hi protein ke liye directly code karti hai, coding strand ko bhi 'sense'/coding kaha jaata hai — jabki dusri strand jo actually template ki tarah copy hoti hai use 'template' ya 'antisense' strand kehte hain.
Do you think a transcription unit and a gene are the same or different? Explain.
Nahi, dono hamesha same nahi hote.
Transcription unit ek DNA segment hoti hai jisme teen parts hote hain — promoter, structural gene, terminator — aur ek unit se ek single RNA transcript banta hai.
Gene functional unit of inheritance hai, aur eukaryotes mein genes 'split' hote hain — exons (coding) aur introns (non-coding) mein divided. Kuch cases mein ek transcription unit mein overlapping genes bhi ho sakte hain (monocistronic vs polycistronic mRNA). Isliye concept alag-alag hai, though practically overlap zyada hota hai.
Can you list two essential roles of ribosome during translation?
- Ribosome catalytic site provide karta hai peptide bond formation ke liye — peptidyl transferase activity actually ribosomal RNA (rRNA) ki hoti hai, ye ek ribozyme hai.
- Ribosome ek 'moving machine' ki tarah kaam karta hai — mRNA ke saath codon-by-codon translocate karta hai, jisse naya codon A-site pe expose hota hai aur tRNA/mRNA ka movement facilitate hota hai.
In the medium where E. coli was growing, lactose was added, which induced the lac operon. Why does the lac operon shut down some time after addition of lactose in the medium?
Lactose ka isomer allolactose inducer ki tarah kaam karta hai — ye repressor protein se bind karke usko operator se hataata hai, jisse structural genes (lacZ, lacY, lacA) transcribe hote hain aur enzymes bante hain jo lactose ko metabolise karte hain.
Jaise-jaise lactose medium mein metabolise hokar khatam hoti jaati hai, allolactose ki concentration bhi gir jaati hai. Inducer kam hote hi repressor active ho jaata hai, wapas operator se bind kar leta hai aur RNA polymerase ko block kar deta hai — isliye operon shut down ho jaata hai. Ye ek negative feedback control ka example hai.
Explain (in one or two lines) the function of the following: (a) Promoter (b) tRNA (c) Exons
(a) Promoter — transcription unit ke 5' end pe present ek DNA sequence jo RNA polymerase ke liye binding site provide karti hai aur decide karti hai kaunsi strand template hai aur transcription kis direction mein hogi.
(b) tRNA — adaptor molecule jo mRNA ke codon ko apne anticodon se recognise karti hai aur us codon ke corresponding specific amino acid ko ribosome tak carry karti hai.
(c) Exons — split gene ke wo coding sequences jo mature mRNA mein appear hote hain (introns splicing ke through remove hone ke baad).
Differentiate between: (a) Repetitive DNA and Satellite DNA (b) mRNA and tRNA (c) Template strand and Coding strand
(a) Repetitive vs Satellite DNA: Repetitive DNA wo sequences hain jo genome mein baar-baar repeat hoti hain, mostly non-coding, aur density gradient centrifugation mein main band banati hain. Satellite DNA repetitive DNA ka wo fraction hai jo apna alag chhota peak ('satellite' peak) banata hai (kyunki iska AT/GC ratio main DNA se different hota hai) — yahi VNTR regions DNA fingerprinting mein use hote hain.
(b) mRNA vs tRNA: mRNA (messenger RNA) DNA se codons ki information ribosome tak carry karti hai; single-stranded, linear. tRNA (transfer/adaptor RNA) clover-leaf shape ki hoti hai, anticodon rakhti hai aur specific amino acid ko ribosome tak deliver karti hai.
(c) Template vs Coding strand: Template strand RNA polymerase dwara copy ki jaati hai (3'→5' padhi jaati hai). Coding (sense) strand copy nahi hoti par mRNA jaisi hi sequence rakhti hai (T ki jagah U).
Write a brief note on: (a) Semi-conservative DNA replication (b) Origin of replication (c) Point mutation (d) Transcription unit
(a) Semi-conservative replication: DNA ki dono strands separate hokar template ka kaam karti hain; har daughter DNA molecule mein ek parental strand aur ek newly synthesised strand hoti hai. Meselson-Stahl experiment (15N/14N labelling) ne ise experimentally prove kiya.
(b) Origin of replication: Genome ka wo specific sequence jahan se DNA replication start hoti hai; replication machinery yahin assemble hoti hai.
(c) Point mutation: Single base pair ke change se hone wali mutation, jaise sickle-cell anaemia mein β-globin gene ka ek base badalne se glutamic acid ki jagah valine aa jaata hai.
(d) Transcription unit: DNA ka segment jisme 3 components hote hain — promoter, structural gene, terminator; ye ek functional unit hai jisse single RNA transcript synthesise hoti hai.
How did Hershey and Chase differentiate between DNA and protein in their experiment while proving that DNA is the genetic material?
Hershey aur Chase ne T2 bacteriophage use kiya jo E. coli ko infect karta hai. Unhone do batches banaye:
- Ek batch ka DNA radioactive 32P se label kiya (kyunki DNA mein phosphate hota hai, sulfur nahi).
- Doosre batch ka protein coat radioactive 35S se label kiya (kyunki protein mein sulfur-containing amino acids hote hain, phosphate nahi).
Dono batches se alag-alag E. coli ko infect karwaya, phir blender mein agitate karke phage coats ko bacteria se separate kiya aur centrifuge kiya.
Result: Jo bacteria 32P-labelled phage se infect hue, unme radioactivity mili (matlab DNA cell ke andar gaya). Jo bacteria 35S-labelled phage se infect hue, unme radioactivity nahi mili (protein bahar hi reh gaya). Isse prove hua ki DNA hi genetic material hai, jo cell ke andar jaake progeny phages banwaata hai — protein nahi.
Briefly describe the process of transcription in eukaryotes and how it is different from prokaryotic transcription.
Eukaryotic transcription mein 3 alag RNA polymerases involve hoti hain — RNA Pol I (rRNA banata hai), RNA Pol II (hnRNA/mRNA banata hai — primary transcript jo baad mein processed hoti hai), aur RNA Pol III (tRNA aur chhoti RNAs banata hai). Pol II ka primary transcript, hnRNA, tabhi functional mRNA banta hai jab uspe teen processing steps ho jaayein:
- Capping — 5' end pe methylated guanosine triphosphate cap add hota hai.
- Tailing — 3' end pe poly-A tail add hoti hai.
- Splicing — introns remove hokar exons join hote hain.
Difference from prokaryotes: Prokaryotes mein sirf ek hi RNA polymerase hoti hai jo sabhi RNA types banati hai, koi post-transcriptional processing nahi hoti (kyunki polycistronic mRNA directly usable hoti hai), aur chunki nuclear membrane nahi hoti, transcription aur translation simultaneously (coupled) hote hain.
Explain the mechanism of splicing. Give its significance.
Eukaryotic primary transcript (hnRNA) mein coding sequences (exons) aur non-coding intervening sequences (introns) dono hote hain. Splicing wo process hai jisme introns precisely remove kiye jaate hain aur exons ek defined order mein join kiye jaate hain, taaki mature functional mRNA bane jo translation ke liye ready ho.
Significance: Splicing exons ko different combinations mein join karne deti hai — isko alternative splicing kehte hain — jisse ek hi gene se multiple protein variants ban sakte hain. Ye limited number of genes se protein diversity generate karne mein help karta hai, jo eukaryotic complexity ka ek reason hai.
Describe the process of translation.
Translation matlab mRNA ke codons ke hisaab se amino acids ko polymerise karke polypeptide chain banana. Steps:
- Activation of amino acids: Amino acid ATP ki energy se activate hokar aminoacyl-AMP banata hai.
- Charging of tRNA: Activated amino acid apni specific (cognate) tRNA se link hokar 'charged tRNA' banata hai — ye reaction aminoacyl tRNA synthetase enzyme karta hai.
- Initiation: Small ribosomal subunit mRNA ke start codon (AUG) pe bind hota hai, initiator tRNA (prokaryotes mein fMet) attach hota hai, phir large subunit join hokar functional ribosome banata hai.
- Elongation: Ribosome codon-by-codon aage badhta hai; A-site pe naya charged tRNA aata hai, peptide bond banta hai (peptidyl transferase — ek ribozyme activity), aur translocation hoti hai.
- Termination: Jab stop codon (UAA, UAG, UGA) A-site pe aata hai, release factor bind hota hai aur polypeptide chain ribosome se release ho jaati hai.
Discuss critically the role of DNA polymerase and RNA polymerase.
DNA polymerase replication ke liye template-dependent enzyme hai — highly efficient aur high-fidelity (isme proof-reading activity hoti hai jo galat base ko correct kar deti hai). Lekin isme ek limitation hai: ye de-novo synthesis start nahi kar sakta — synthesis shuru karne ke liye ek free 3'-OH end wale RNA primer ki zaroorat hoti hai, aur ye sirf 5'→3' direction mein hi kaam karta hai.
RNA polymerase transcription ke liye template-dependent enzyme hai. Prokaryotes mein ek hi enzyme initiation, elongation aur termination sab karta hai (sigma factor initiation ke liye, rho factor kuch terminators ke liye zaroori hota hai). Isko primer ki zaroorat nahi hoti, aur generally isme proof-reading activity nahi hoti (kyunki RNA transient molecule hai, error accumulate nahi hote generations mein) — isliye RNA polymerase ki fidelity DNA polymerase se kam hoti hai, jo biologically acceptable hai.
Both lac I gene and lac operon genes are transcribed from their respective promoters. What will be the pattern of expression of the lac operon in a strain when the lac I gene has a mutation in (a) its promoter, and (b) the operator region?
(a) Mutation in lac I gene's own promoter: Repressor protein banega hi nahi (kyunki lac I gene khud transcribe nahi ho paayega). Repressor absent hone se operator kabhi block nahi hoga — result: lac operon constitutively (hamesha) expressed rahega, chahe lactose ho ya na ho.
(b) Mutation in operator region of lac operon: Repressor normally ban to jaayega, lekin agar operator sequence itni badal jaaye ki repressor usse bind hi na kar paaye, to bhi structural genes (Z, Y, A) continuously expressed rahenge — kyunki repressor bind hi nahi kar paa raha, isliye RNA polymerase ko block karne wala kuch nahi hai.
Important Equations — Ek Nazar Me
| Concept | Key rule / fact |
|---|---|
| Chargaff's Rule (dsDNA) | %A = %T, %G = %C, isliye %A + %G = %T + %C = 50% |
| DNA helix dimensions (Watson-Crick model) | 10 base pairs / turn · rise = 3.4 Å (0.34 nm) per bp · pitch = 34 Å (3.4 nm) per turn · diameter = 20 Å |
| Central Dogma | DNA →(replication)→ DNA; DNA →(transcription)→ RNA →(translation)→ Protein. Exception: retroviruses mein RNA →(reverse transcriptase)→ DNA |
| Genetic code — total codons | 43 = 64 codons → 61 sense codons + 3 stop codons (UAA, UAG, UGA) |
| Start codon | AUG — Methionine (prokaryotes mein fMet) code karta hai, initiator ki tarah bhi kaam karta hai |
| Genetic code properties | Triplet · Degenerate (multiple codons → 1 amino acid) · Unambiguous (1 codon → sirf 1 amino acid) · Nearly Universal · Non-overlapping · Comma-less (continuous reading) |
| Wobble hypothesis | Codon ke 3rd base (5' end of anticodon se pair) mein flexibility hoti hai — isliye ek tRNA multiple synonymous codons recognise kar sakta hai |
| Meselson–Stahl experiment (15N/14N) | Gen 0: all heavy (15N-15N) · Gen 1: all hybrid (15N-14N) · Gen 2: 50% hybrid + 50% light (14N-14N) → semi-conservative replication proved |
| lac operon genes | lac Z = β-galactosidase · lac Y = permease · lac A = transacetylase · lac I = regulator gene (repressor synthesise karta hai, apne alag promoter se) |
| Eukaryotic mRNA processing | 5' capping (methyl-G cap) + 3' tailing (poly-A tail) + splicing (intron removal, exon joining) |
| RNA polymerases (eukaryotes) | Pol I → rRNA · Pol II → hnRNA/mRNA · Pol III → tRNA + small RNAs |
↔ Table ko side me swipe karein
Common Mistakes — Yahan Marks Kat te Hain
- Template strand ko coding strand samajh lena — RNA polymerase actually template strand (3'→5') ko padhta hai, jabki mRNA ka sequence coding/sense strand jaisa hota hai (bas T→U).
- Ye sochna ki DNA polymerase khud replication start kar sakta hai bina primer ke — DNA polymerase sirf existing free 3'-OH end pe nucleotide add kar sakta hai, isliye RNA primer zaroori hai.
- Semi-conservative replication ko conservative ya dispersive model se confuse karna — sahi definition: har daughter DNA molecule mein ek parental strand + ek naya strand hota hai, poori strand purani nahi rehti aur poora molecule mix bhi nahi hota.
- Genetic code ko 'degenerate' aur 'ambiguous' ek jaisa samajh lena — code degenerate hai (multiple codons ek amino acid ke liye) lekin ambiguous nahi hai (ek codon hamesha sirf ek hi amino acid specify karta hai).
- Introns ko coding/expressed samajh lena — actually exons hi expressed hote hain, introns splicing ke dauraan remove ho jaate hain aur mature mRNA mein nahi hote.
- Lac operon mein likh dena ki repressor promoter se bind hota hai — galat hai; repressor operator region se bind hota hai, promoter to RNA polymerase ki binding site hai.
Board-Style Important Questions
- Hershey aur Chase ke experiment ka description dijiye jisne prove kiya ki DNA hi genetic material hai, protein nahi.
- Meselson-Stahl experiment ke through DNA ki semi-conservative mode of replication kaise prove hui — steps sahit samjhaiye.
- lac operon ka structure diagram sahit describe kijiye, aur lactose ki presence aur absence dono conditions mein iska regulation explain kijiye.
- Transcription unit ke teen components likhiye aur unke functions bataiye. Prokaryotic aur eukaryotic transcription mein kya-kya antar hai?
- Genetic code ki kam se kam paanch properties likhiye aur har ek ko ek line mein explain kijiye.
- DNA fingerprinting technique ka principle kya hai, aur ye forensic science mein kaise use hoti hai — short note likhiye.
Aksar Poochhe Jaane Wale Sawaal
Molecular Basis of Inheritance NCERT PDF kahan se download karein?
Sabse reliable tareeka hai official NCERT website — ncert.nic.in — se directly Class 12 Biology textbook ka PDF download karna. Wahan chapter-wise PDF free milte hain, aur 'class 12 biology ncert book pdf download 2026-27' search karke aap seedha current rationalised edition (2026-27 session) tak pahunch sakte ho. Third-party sites ke PDFs kabhi purane edition ke hote hain, isliye official source hi best hai.
Class 12 Biology 2026-27 session ke liye kitne chapters hain, aur deleted syllabus mein kya-kya aaya?
Rationalisation ke baad current NCERT Class 12 Biology mein 13 chapters hain, 4 units mein: Unit VI Reproduction (Ch 1-3), Unit VII Genetics and Evolution (Ch 4-6, jisme Molecular Basis of Inheritance Ch 5 hai), Unit VIII Biology in Human Welfare (Ch 7-8), Unit IX Biotechnology (Ch 9-10), Unit X Ecology (Ch 11-13).
Agar aap 'class 12 biology deleted syllabus 2026-27' dhoondh rahe ho — official contents page ke hisaab se jo purane pre-rationalisation chapters ab is listing mein nahi hain wo hain: 'Reproduction in Organisms', 'Strategies for Enhancement in Food Production', aur 'Environmental Issues'.
Molecular Basis of Inheritance se pehle aur baad mein konse chapters padhne chahiye?
Sequence follow karna best hai. Isse pehle Chapter 4 Principles of Inheritance and Variation ki notes clear karo (Mendel's laws) — usi ka molecular explanation ye chapter deta hai. Iske baad Chapter 6 Evolution aata hai, jiske notes Hindi mein bhi available milte hain agar aap 'evolution class 12 biology notes in hindi' search karo.
Reproduction unit (Ch 1-3) — 'sexual reproduction in flowering plants ncert solutions' aur 'human reproduction class 12 important questions' — inheritance samajhne se pehle helpful background dete hain, though optional hain is chapter ke liye.
Molecular Basis of Inheritance ka forward units — Human Welfare aur Biotechnology — se kya connection hai?
Bahut deep connection hai. Unit VIII mein Human Health and Disease (agar 'human health and disease class 12 important questions pdf' dhoond rahe ho) mein genetic disorders aur immunity ka molecular basis yahin se aata hai, aur Microbes in Human Welfare ('microbes in human welfare class 12 ncert solutions') mein fermentation/antibiotics ke peeche gene expression concepts kaam aate hain.
Unit IX ke Biotechnology Principles and Processes ('biotechnology principles and processes class 12 notes') aur Biotechnology and its Applications ('biotechnology and its applications ncert pdf class 12') — dono directly replication, transcription aur restriction enzymes wale concepts pe based hain jo Chapter 5 mein padhaye jaate hain.
Lac operon board exam mein kaise pucha jaata hai, aur kya-kya likhna zaroori hai?
Lac operon usually diagram + explanation type question hota hai. Zaroori points: structure (regulator gene lac I, promoter, operator, structural genes Z-Y-A), presence of lactose mein regulation (allolactose inducer → repressor inactivate → transcription ON), aur absence of lactose mein regulation (repressor active → operator block → transcription OFF). Ye negative feedback control ka classic example hai, isliye 'switch off kyun hota hai' wala part bhi likhna important hai.
Central Dogma aur genetic code ke topics ko revise karne ka best tareeka kya hai?
Pehle Central Dogma ka flow yaad karo — DNA → RNA → Protein (aur retrovirus wala exception, RNA → DNA). Phir genetic code ki properties (triplet, degenerate, unambiguous, universal, non-overlapping, comma-less) ek-ek karke likhkar practice karo, kyunki ye direct 'properties likho' wale questions mein aata hai. Numerical questions (base % calculation, complementary strand, mRNA sequence) bhi zaroor practice karo — inme step-by-step working dikhana marks ke liye important hai.
Class 12 Biology — Saare Chapters

Board exam tak sirf revision karna hai?
Class 12 Biology ke saare chapters ke colour handwritten short notes — diagrams, formulas aur important points ek jagah.
NCERT Kaksha ek swatantra shaikshik platform hai aur NCERT ya CBSE se aadhikarik roop se sambaddh (officially affiliated) nahi hai. Kisi galti ki jaankari dene ke liye contact kijiye.